IthaID: 4093
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 95 (-C) | HGVS Name: | HBA1:c.287delC |
| Hb Name: | Hb Campania | Protein Info: | N/A |
Context nucleotide sequence:
TGCACGCGCACAAGCTTCGGGTGGACC [C/-] GGTCAACTTCAAGGTGAGCGGCGGGCC (Strand: +)
Also known as:
Comments: The C deletion at codon 95, results in a frameshift, that gives rise to a premature stop codon at position 101 leading to a truncated protein. Found in a family in Naples and both carriers showed mild α-thalassemia haematological alterations. HPLC and electrophoresis revealed no abnormal haemoglobin or globin chains. However, both qualitative and semiquantitative analyses of the mRNA from the carrier’s reticulocytes revealed a decrease in mutant mRNA constituted 34% (Hb Campania) of total α1-globin mRNA. The analyses of the 3D models indicate that the Hb Campania is unstable.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia, α-chain variant |
| Allele Phenotype: | N/A |
| Stability: | Unstable |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 37983 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Southern Italian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Cardiero G, Musollino G, Prezioso R, Lacerra G, mRNA Analysis of Frameshift Mutations with Stop Codon in the Last Exon: The Case of Hemoglobins Campania [α1 cod95 (-C)] and Sciacca [α1 cod109 (-C)]., Biomedicines, 9(10), , 2021