IthaID: 4090
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | --Mococa (17 kb deletion) | HGVS Name: | NC_000016.10:g.(162059_162078)_(179126_179145)del |
| Hb Name: | N/A | Protein Info: | N/A |
Also known as:
Comments: This deletion spans approximately 17 kb on the α-globin gene locus, removing both HBA2 and HBA1 genes, as well as HBAP1, HBM and HBZP1. The breakpoints are located in two 20 nucleotides repeats (GCCTGTAATCCCAGCTACTC) at positions 16:162,059-162,078 and 16:179,126-179,145 (GRCh38). Codominant inheritance.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α0 |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | N/A |
| Size: | 17 kb |
| Deletion involves: | α2, α1 |
Other details
| Type of Mutation: | Deletion |
|---|---|
| Ethnic Origin: | Brazilian |
| Molecular mechanism: | N/A |
| Inheritance: | N/A |
| DNA Breakpoint Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | da Luz, Julio | 2023-12-29 | First report. |
Created on 2024-01-15 15:55:03,
Last reviewed on 2024-01-15 15:56:59 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.