IthaID: 4090

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: --Mococa (17 kb deletion) HGVS Name: NC_000016.10:g.(162059_162078)_(179126_179145)del
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Comments: This deletion spans approximately 17 kb on the α-globin gene locus, removing both HBA2 and HBA1 genes, as well as HBAP1, HBM and HBZP1. The breakpoints are located in two 20 nucleotides repeats (GCCTGTAATCCCAGCTACTC) at positions 16:162,059-162,078 and 16:179,126-179,145 (GRCh38). Codominant inheritance.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α0
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: N/A
Size: 17 kb
Deletion involves: α2, α1

Other details

Type of Mutation: Deletion
Ethnic Origin: Brazilian
Molecular mechanism: N/A
Inheritance: N/A
DNA Breakpoint Determined: Yes

In silico pathogenicity prediction

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1da Luz, Julio2023-12-29First report.
Created on 2024-01-15 15:55:03, Last reviewed on 2024-01-15 15:56:59 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.