IthaID: 4077


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 37 CCC>CC- HGVS Name: HBA1:c.114del
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CCGCAGGATGTTCCTGTCCTTCCC [C/-] ACCACCAAGACCTACTTCCCGCACT (Strand: +)

Also known as:

Comments: Detected in a heterozygous state in a pregnant female presenting with mild hypochromic anemia. Functional analysis revealed that this variation considerably reduced the expression of the HBA1 protein.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37810
Size: 1 bp
Located at: α1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Zhang W, Han X, Deng J, Zhou R, Du X, Wu C, Li M, Two Novel α-Thalassemia Mutations CD 39 -C [Thr > Pro] and CD 109 ACC > CCC [Thr > Pro] Identified in Two Chinese Families: A Case Report., Hemoglobin, 47(4), 172-179, 2023
Created on 2023-11-13 13:05:45, Last reviewed on 2023-11-13 13:19:33 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.