IthaID: 4074


Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: N/A
Common Name: -352 A>G HGVS Name: HBG1:c.-404A>G

Context nucleotide sequence:
CACTGGAGCTAGAGACAAGAAGGT [A>G] AAAAACGGCTGACAAAAGAAGTC (Strand: -)

Also known as:

Comments: A potentially neutral variation detected in the heterozygous state in an individual with elevated HbF (Hb F 4.3%) together with -365 G>C [IthaID: 3887] and Aγ(+25 G>A) [ithaID=2945] in HBG1 and -158 C>T [ithaID=2127] in HBG2. Phenotypic information: Hb 128g/L, MCV 99fL, MCH 32.1pg, Hb A 93%, Hb A2 2.7%, Hb F 4.3%.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 47407
Size: 1 bp
Located at:
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Chinese Han
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Zhuang, Qianmei 2023-09-25First report.
Created on 2023-11-01 16:42:57, Last reviewed on 2023-11-01 16:53:19 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.