IthaID: 4064

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD109/110 (-GCT +CAGCACGATG) HGVS Name: HBB:c.330_332delinsCAGCACGATG
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TTATCTTCCTCCCACAGCTCCTGGGCAACGT [-/CAGCACGATG] GGTCTGTGTGCTGGCCCATCACTTTGGCAAA (Strand: -)

Comments: Found in a female newborn together with Hb Zurich-Langstrasse, HBB:c.[151A>T;316-197C>T], by DNA sequencing. CBC: Hb 17.4 g/dL, MCV 99.0 fL, MCH 33.9 pg, MCHC 343 g/L. CE: Hb F 100%.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71904
Size: 3 bp
Located at: β

Other details

Type of Mutation: Insertion & Deletion
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Li, Youqiong2023-07-31First report.
Created on 2023-08-04 09:40:55, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.