IthaID: 4063


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 15 (-G, +CC) HGVS Name: HBA2:c.47delinsCC
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
AAGACCAACGTCAAGGCCGCCTGGG [G/CC] TAAGGTCGGCGCGCACGCTGGCGAGTAT (Strand: +)

Protein sequence:
MVLSPADKTNVKAAWKX

Also known as:

Comments: This is an indel mutation that deletes a G nucleotide from codon 15 in exon 1 of the HBA2 gene and inserts two C nucleotides. Frameshift resulting in a shortened α-globin chain with a stop codon at codon 16 [AAG>TAA]. The mutation was found in one Malay individual with the Hb level of 12.2 g/dL, MCV level of 71.1 fl and MCH level of 23.2 pg.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33822
Size: 1 bp
Located at: α2

Other details

Type of Mutation: Insertion & Deletion
Ethnic Origin: Malay
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Abdul Hamid, Faidatul Syazlin2023-07-06First report.
Created on 2023-07-13 10:09:27, Last reviewed on 2023-07-13 10:13:06 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.