IthaID: 405

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 116 GAG>TAG HGVS Name: HBA2:c.349G>T
Hb Name: N/A Protein Info: α2 116(GH4) Glu>Stop
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GACCCTGGCCGCCCACCTCCCCGCC [A/C/G/T] AGTTCACCCCTGCGGTGCACGCCTC (Strand: +)

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34383
Size: 1 bp
Located at: α2
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Nonsense codon (Translation)
Ethnic Origin: African
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Liebhaber SA, Coleman MB, Adams JG, Cash FE, Steinberg MH, Molecular basis for nondeletion alpha-thalassemia in American blacks. Alpha 2(116GAG----UAG)., The Journal of clinical investigation, 80(1), 154-9, 1987
Created on 2010-06-16 16:13:15, Last reviewed on 2014-04-08 17:36:24 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.