IthaID: 4048
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1046747 | HGVS Name: | NC_000010.11:g.70150874G>A |
Context nucleotide sequence:
CCACAAGTCAGTACTGGAGAATAA [G>A] AATGAGAACTCCAACTAAAGAACA (Strand: +)
Also known as:
Comments: Associated with a change in total hemoglobin levels after HU treatment in SS patients.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Response to hydroxyurea |
Location
| Chromosome: | 10 |
|---|---|
| Locus: | NM_001142648.2 |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | SAR1A |
| Specific Location: | 3'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Kumkhaek C, Kim C, Kurban G, Zhu J, Aerbajinai W, Taylor JG, Rodgers GP, Single nucleotide polymorphisms in coding regions in sickle cell disease and their potential miRNA binding sites., EJHaem, 3(4), 1438-1441, 2022
Created on 2023-07-04 16:29:23,
Last reviewed on 2023-07-04 16:41:20 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.