IthaID: 4047


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs1470556171 HGVS Name: NC_000010.11:g.70151281A>C

Context nucleotide sequence:
CATACCAAAAAAAAAAAAAAAAAAAAA [A>C] AAACCTGGAAAAGCTACAGATGTTAACC (Strand: +)

Also known as:

Comments: Associated with baseline % HbF levels in SS patients.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 10
Locus: NM_001142648.2
Locus Location: N/A
Size: 1 bp
Located at: SAR1A
Specific Location: 3'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Kumkhaek C, Kim C, Kurban G, Zhu J, Aerbajinai W, Taylor JG, Rodgers GP, Single nucleotide polymorphisms in coding regions in sickle cell disease and their potential miRNA binding sites., EJHaem, 3(4), 1438-1441, 2022
Created on 2023-07-04 16:20:06, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.