IthaID: 4046

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: IVS II-337 A>G HGVS Name: HBB:c.315+337A>G
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TTTACACAGTCTGCCTAGTACATTACT [A>G] TTTGGAATATATGTGTGCTTATTTGCA (Strand: -)

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71376
Size: 1 bp
Located at: β
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Liu Q, Chen Q, Zhang Z, Peng S, Liu J, Pang J, Jia Z, Xi H, Li J, Chen L, Liu Y, Peng Y, Identification of rare thalassemia variants using third-generation sequencing., Front Genet, 13(0), 1076035, 2022
Created on 2023-07-04 14:15:44, Last reviewed on 2023-07-04 14:17:18 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.