IthaID: 4025
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | Poly A (-T) AATAAA>AA-AAA | HGVS Name: | HBB:c.*110del |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CCTTGAGCATCTGGATTCTGCCTAA [T/-] AAAAAACATTTATTTTCATTGCAAT (Strand: +)
Also known as:
Comments: The mutation deletes single nucleotide (-T) in the Poly A conserved region of the HBB gene thus may caused inefficient cleavage and polyadenylation of mRNA at the normal poly A site. This mutation most likely presented as beta plus mutation. This mutation was found in one individual with Hb level of 13.2 g/dL and had a HbA2 level of 3.8% by CE method. Common alpha thalassaemia (deletion and non-deletional) were tested and no alpha thalassaemia was detected.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β+ |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72128 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Poly(A) |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | RNA cleavage - Poly(A) signal (mRNA Processing) |
| Ethnic Origin: | Malay |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Abdul Hamid, Faidatul Syazlin | 2023-05-22 | First report. |