IthaID: 4024
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 15 (-GG, +C) | HGVS Name: | HBA2:c.46_47delinsC |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CAAGACCAACGTCAAGGCCGCCTGG [GG/C] TAAGGTCGGCGCGCACGCTGGCGA (Strand: +)
Also known as:
Comments: This is a frameshift variation that deletes two nucleotides (GG) from codon 15 in exon 1 of the HBA2 gene and inserts a C nucleotide. Results in a shortened α-globin chain with a stop codon at codon 48. Fοund together with heterozygous Hb Constant Spring [IthaID: 418] in a person of Malay origin: Hb 12 g/dL, MCV 67.1 fl, MCH 20.2 pg.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 33821 |
| Size: | 2 bp |
| Located at: | α2 |
Other details
| Type of Mutation: | Insertion & Deletion |
|---|---|
| Ethnic Origin: | Malay |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Abdul Hamid, Faidatul Syazlin | 2023-05-19 | First report. |
Created on 2023-05-22 09:00:05,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.