
IthaID: 4018
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | 3'UTR +132 C>G | HGVS Name: | HBB:c.*132C>G |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GCCTAATAAAAAACATTTATTTTCATTG [C>G] AATGATGTATTTAAATTATTTCTGAATAT (Strand: -)
Comments: Found together with a β0-thal allele in a 5-year-old boy with thalassemia intermedia. Heterozygous relatives had normal MCV and HbA2. This variant is reported to cause silent β-thalassemia.
External Links
No available links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β++ (silent) |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 72150 |
Size: | 1 bp |
Located at: | β |
Specific Location: | 3'UTR |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Chinese |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Wen YJ, Yu QX, Jiang F, Li DZ, Identification of a Novel Mutation in the 3' Untranslated Region of the -Globin Gene (HBB:c.*132C>G) in a Chinese Family., Hemoglobin, 46(6), 347-350, 2022
Created on 2023-03-21 10:24:29,
Last reviewed on 2023-04-03 10:38:07 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.