IthaID: 4018
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | 3'UTR +132 C>G | HGVS Name: | HBB:c.*132C>G |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GCCTAATAAAAAACATTTATTTTCATTG [C>G] AATGATGTATTTAAATTATTTCTGAATAT (Strand: -)
Also known as:
Comments: Found together with a β0-thal allele in a 5-year-old boy with thalassemia intermedia. Heterozygous relatives had normal MCV and HbA2. This variant is reported to cause silent β-thalassemia.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β++ (silent) |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72150 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | 3'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Wen YJ, Yu QX, Jiang F, Li DZ, Identification of a Novel Mutation in the 3' Untranslated Region of the -Globin Gene (HBB:c.*132C>G) in a Chinese Family., Hemoglobin, 46(6), 347-350, 2022
Created on 2023-03-21 10:24:29,
Last reviewed on 2023-04-03 10:38:07 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.