IthaID: 4009
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD53 GCC>ACC [Ala>Thr] | HGVS Name: | HBA1:c.160G>A |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CACTTCGACCTGAGCCACGGCTCT [G>A] CCCAGGTTAAGGGCCACGGCAAG (Strand: +)
Also known as: g.443 (GenBank MK600512.1)
Comments: Reported among alpha-thalassemia patients followed-up in a clinic in the south of Thi Qar province.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α⁺ |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 37856 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Iraqi |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Odah Al-Musawi AH, Jumaah Alhussna A, Hussein Jalood H, Genetic Analysis of Alpha-Thalassemia Mutations in Thi-Gar Province, Iraq., Arch Razi Inst, 77(3), 976-980, 2022
Created on 2023-01-23 12:35:31,
Last reviewed on 2023-01-23 12:37:22 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.