IthaID: 4000
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs2238104 | HGVS Name: | NC_000012.12:g.6078499G>T |
Context nucleotide sequence:
CACTGAACTCAGAGTGCAGATGAGG [G>T] TGTCCCAGAGAGGGTCATGTGCTCAG (Strand: +)
Also known as:
Comments: Associated with an increased risk of proteinuria in sickle cell disease cohorts (n 524 OMG-SCD, n 465 WalkPHaSST). This variant is an eQTL for r CHD4 and CD9 in glomerulus. CHD4 has been identified as a γ-globin silencer, controlling the switch from fetal to adult hemoglobin, while CD9 is a tetraspanin implicated in focal segmental glomerulosclerosis (FSGS)."
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Proteinuria [HP:0000093] |
Location
| Chromosome: | 12 |
|---|---|
| Locus: | NG_009072.2 |
| Locus Location: | 51172 |
| Size: | 1 bp |
| Located at: | VWF |
| Specific Location: | Intron 6 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Garrett ME, Soldano KL, Erwin KN, Zhang Y, Gordeuk VR, Gladwin MT, Telen MJ, Ashley-Koch AE, Genome-wide meta-analysis identifies new candidate genes for sickle cell disease nephropathy., Blood Adv, 2022
Created on 2023-01-17 14:57:08,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.