IthaID: 3990
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | -89 to -88 (-AC) | HGVS Name: | HBB:c.-139_-138delAC |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
ACTTAGACCTCACCCTGTGGAGCCAC [AC/-] CCTAGGGTTGGCCAATCTACTCCCA (Strand: +)
Also known as:
Comments: Identified in a heterozygous state by NGS and validated by Sanger sequencing. No other mutations were found in the HBB, HBA1 and HBA2 genes by NGS and PCR analyses. The 2-bp deletion is found in the HBB region from -92 to -88 nt, which overlaps the proximal CACCC box. The β-globin gene promoter relies on the proximal CACCC box for correct regulation. The phastCons and PhyloP, which are two in silico tools for identifying evolutionarily conserved elements, showed that the sequences between -93 and -86 (CCACACCC) are highly conserved with a core sequence CACCC. The proband had normal red blood cell (RBC) indices, only with a slightly decreased red blood corpuscular volume distribution width (RDW) determined by a hematology analyzer (XN-9000, Sysmex). Hemoglobin analysis was performed by capillary electrophoresis (Capillarys 2 FIEX PIERCING, Sebia). The proband had 93.1% HbA (lower than normal), 4.2% Hb A2 and 2.7% Hb F (higher than normal).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β++ (silent) |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70456 |
Size: | 2 bp |
Located at: | β |
Specific Location: | Promoter |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Promoter (Transcription) |
Ethnic Origin: | Chinese |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Pan L, Tian P, Chen S, Zhang R, Novel Promoter Mutation (:C.-139_-138del) Associated with β-Thalassemia Trait Detected by Next-Generation Sequencing in Southern China., Hemoglobin, 2023
Microattributions
A/A | Contributor(s) | Date | Comments |
---|---|---|---|
1 | Pan, Lei | 2022-12-13 | First report. |
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2022-12-13 12:33:35 | The IthaGenes Curation Team | Created |
2 | 2022-12-13 12:35:17 | The IthaGenes Curation Team | Reviewed. Contribution added. |
3 | 2023-03-08 12:12:13 | The IthaGenes Curation Team | Reviewed. Reference added. |
4 | 2023-03-08 12:12:42 | The IthaGenes Curation Team | Reviewed. Reference |