IthaID: 3965
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 84-87 (-CTTTGCCACA) (+TTTTTCTCAG) | HGVS Name: | HBB:c.255_264delinsTTTTTCTCAG |
| Hb Name: | Hb Wanjiang | Protein Info: | N/A |
Context nucleotide sequence:
CCTGGACAACCTCAAGGGCAC [CTTTGCCACA/TTTTTCTCAG] CTGAGTGAGCTGCACTGTGAC (Strand: -)
Also known as: Hb Donguan-Dongcheng
Comments: Found in a male and his father presented with normal hematological features. The variant results from a 10 bp deletion at codons 84-87 of the β-globin chain, replaced with 10 nucleotides coming from the δ-globin gene at the same position, leading to the substitution of two amino acids in the peptide chain with no change in the β-globin chain length. The abnormal Hb variant was not detectable by CE and HPLC. Found in 8 healthy individuals from southern China during premarital/antenatal screening.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-chain variant |
| Allele Phenotype: | N/A |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70979 |
| Size: | 10 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Wu SM, Jiang F, Li C, Guo ZT, Huang SR, Li DZ, Hb Wanjiang: A New β-Globin Chain Variant with Two Amino Acid Substitutions (: c.255_264delinsTTTTTCTCAG)., Hemoglobin, 2022
- Zhang Q, Wang G, Sun D, Lin W, Yan T, Wu Y, Wu M, Chen J, Zou S, Xie W, Zhou Y, Wang Y, He L, Liu Y, Qiu Z, Hu L, Lin B, Zhou X, Li Y, Xu X, MALDI-TOF-MS for Rapid Screening and Typing of β-Globin Variant and β-Thalassemia through Direct Measurements of Intact Globin Chains., Clin Chem, 2022