IthaID: 3960

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 29 GGC>GGT [Gly>Gly] HGVS Name: HBD:c.90C>T
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GCAGTTGGTGGTGAGGCCCTGGG [C/T] GCAGTTGGTGGTGAGGCCCTGGG (Strand: -)

Comments: Although the C>T variant produces a synonymous amino acid, also creates a new GT 5’ donor splice site at position c.89_90 of codon 24, which will affect the normal authentic splice site at position c.92+1.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: δ-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 63272
Size: 1 bp
Located at: δ
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Splice junction (mRNA Processing)
Ethnic Origin: Arabian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Created on 2022-08-11 15:38:40, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.