IthaID: 3921

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs964184 HGVS Name: NC_000011.10:g.116778201G>C

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TAATCACCATCTGATGTACTGTTTTCCT [G>C] ATCTGTTTATTGTCATTTTTCCCCACTAG (Strand: +)

Comments: The G allele associated with increased levels of triglycerides (TG) in children over 10 years old and the atherogenic ratio TG/HDL-C in a cohort of SCD.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NM_003904.5
Locus Location: N/A
Size: 1 bp
Located at: ZPR1
Specific Location: 3'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Brazilian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Valente-Frossard TNS, Cruz NRC, Ferreira FO, Belisario AR, Pereira BM, Gomides AFF, Resende GAD, Carlos AM, Moraes-Souza H, Velloso-Rodrigues C, Polymorphisms in genes that affect the variation of lipid levels in a Brazilian pediatric population with sickle cell disease: rs662799 APOA5 and rs964184 ZPR1., Blood Cells Mol Dis, 80(0), 102376, 2020
Created on 2022-05-09 17:37:52, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.