IthaID: 3920
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | -368 C>A | HGVS Name: | HBG1:c.-420C>A |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
TTAAACTACAGGCCTCACTGGAG [C/A] TAGAGACAAGAAGGTAAAAAACG (Strand: -)
Also known as:
Comments: Found in a case in association with HBG1:c.-272_-275dup [IthaID:3865], presented with Hb 15.6 g/dL, MCV 85.2 fL and MCH 28.1 pg. Haemoglobin electrophoresis shown HbA 85.4%, HbA2 2.5% and HbF 11.6% and a small abnormal peak of 0.5% appears next to Hb A2.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Hemoglobinopathy Group: | HPFH |
|---|---|
| Hemoglobinopathy Subgroup: | HPFH |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 47391 |
| Size: | 1 bp |
| Located at: | Aγ |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Han Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
| A/A | Contributor(s) | Date | Comments |
|---|---|---|---|
| 1 | Zhuang, Qianmei | 2022-05-06 | First report. |
Created on 2022-05-09 13:06:24,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.