IthaID: 392

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	IVS II-142 G>A	HGVS Name:	HBA2:c.301-1G>A
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
CCCCACTGACCCTCTTCTCTGCACA [G>A] CTCCTAAGCCACTGCCTGCTGGTGACCCTG (Strand: +)

Also known as:

Comments: Mutation involves the splice acceptor site (AG>AA) and thus affects RNA processing, leading to a complete suppression of the alpha-globin chain production. Patient presents with Hb H disease.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

ClinVar

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	α-thalassaemia
Allele Phenotype:	α⁺
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	16
Locus:	NG_000006.1
Locus Location:	34334
Size:	1 bp
Located at:	α2
Specific Location:	Intron 2

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	Consensus splice site (mRNA Processing)
Ethnic Origin:	Arab/Italian
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Publications / Origin

Noguera NI, González FA, Dávoli RA, Milani AC, Villegas A, A novel splice acceptor site mutation of the alpha2-globin gene causing alpha-thalassemia., Hemoglobin, 25(3), 311-5, 2001

Created on 2010-06-16 16:13:15, Last reviewed on 2016-09-06 11:53:37 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:15	The IthaGenes Curation Team	Created
2	2013-10-15 17:28:32	The IthaGenes Curation Team	Reviewed.
3	2014-05-06 12:27:58	The IthaGenes Curation Team	Reviewed. Locus location corrected.
4	2016-09-06 11:34:05	The IthaGenes Curation Team	Reviewed. Mutation name and location updated. Mutation comment and context sequence added. Allele phenotype updated.
5	2016-09-06 11:41:31	The IthaGenes Curation Team	Reviewed.
6	2016-09-06 11:44:49	The IthaGenes Curation Team	Reviewed. Location updated. dbSNP added.
7	2016-09-06 11:53:37	The IthaGenes Curation Team	Reviewed.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.