IthaID: 3911
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs796512567 | HGVS Name: | NC_000006.12:g.135097900_135097901delinsA |
Context nucleotide sequence:
GGTTATTTACAGTTTTTTCACAAGCAA [CC>A] CTGCTGTATTTCTGTGCACAGATATA (Strand: +)
Also known as:
Comments: Associated with increased HbF levels as well as clinical outcomes (risk of acute syndrome and infections) in pediatric patients with SCA from southeastern Brazil (n=250).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] Acute chest syndrome |
Location
Chromosome: | 6 |
---|---|
Locus: | NT_025741.15 |
Locus Location: | N/A |
Size: | 2 bp |
Located at: | HBS1L-MYB |
Specific Location: | N/A |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Brazilian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Sales RR, Belisário AR, Faria G, Mendes F, Luizon MR, Viana MB, Functional polymorphisms of BCL11A and HBS1L-MYB genes affect both fetal hemoglobin level and clinical outcomes in a cohort of children with sickle cell anemia., Ann Hematol, 99(7), 1453-1463, 2020
Created on 2022-03-30 15:54:19,
Last reviewed on 2022-03-31 11:13:31 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2022-03-30 15:54:19 | The IthaGenes Curation Team | Created |
2 | 2022-03-31 11:13:31 | The IthaGenes Curation Team | Reviewed. Phenotype and Comment. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-18 10:10:45