IthaID: 3910
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs2250806 | HGVS Name: | NC_000001.11:g.84130407A>G |
Context nucleotide sequence:
AACAAGTACCTCAAATTATGAGAAAGA [A>G ] TGGAGACAACCCAGAAAAGAGTCAGT (Strand: +)
Also known as:
Comments: Associated with silent cerebral infarction in patients with sickle cell disease from the South East London sickle gene bank (London, UK).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Stroke [HP:0001297] [OMIM:601367] |
Location
| Chromosome: | 1 |
|---|---|
| Locus: | NG_029728.1 |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | PRKACB |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Brewin JN, Rooks H, Gardner K, Senior H, Morje M, Patel H, Calvet D, Bartolucci P, Thein SL, Menzel S, Rees DC, Genome wide association study of silent cerebral infarction in sickle cell disease (HbSS and HbSC)., Haematologica, 106(6), 1770-1773, 2021
Created on 2022-03-29 13:40:33,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.