IthaID: 3909


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs10142478 HGVS Name: NC_000014.9:g.21481668C>A

Context nucleotide sequence:
AAACATGTTCACAACAACTTTATTCTTA [C>A] TAGCTTAACCCTGAAAACAACTCATGTC (Strand: +)

Also known as:

Comments: Associated with silent cerebral infarction in patients with sickle cell disease from the South East London sickle gene bank (London, UK).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Stroke [HP:0001297] [OMIM:601367]

Location

Chromosome: 14
Locus: N/A
Locus Location: N/A
Size: 1 bp
Located at: TOX4
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Brewin JN, Rooks H, Gardner K, Senior H, Morje M, Patel H, Calvet D, Bartolucci P, Thein SL, Menzel S, Rees DC, Genome wide association study of silent cerebral infarction in sickle cell disease (HbSS and HbSC)., Haematologica, 106(6), 1770-1773, 2021
Created on 2022-03-29 13:38:03, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.