IthaID: 3903
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs60503510 | HGVS Name: | NC_000006.12:g.43849865C>T |
Context nucleotide sequence:
CAGATCACAATGGCCTTTCAGTCCA [C>T] GGTCTCACTTTACAGATGAGGAAA (Strand: +)
Also known as:
Comments: SNV associated with priapism in a patient sample from the REDS-III Brazil SCD cohort. The minor allele had a protective effect against priapism.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Priapism [HP:0200023] [OMIM:176620] |
Location
| Chromosome: | 6 |
|---|---|
| Locus: | NR_149142.1 |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | LINC02537 |
| Specific Location: | Intron |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Brazilian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Cintho Ozahata M, Page GP, Guo Y, Ferreira JE, Dinardo CL, Carneiro-Proietti ABF, Loureiro P, Mota RA, Rodrigues DOW, Belisario AR, Maximo C, Flor-Park MV, Custer B, Kelly S, Sabino EC, , Clinical and Genetic Predictors of Priapism in Sickle Cell Disease: Results from the Recipient Epidemiology and Donor Evaluation Study III Brazil Cohort Study., J Sex Med, 16(12), 1988-1999, 2019
Created on 2022-03-24 16:45:05,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.