IthaID: 3900


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs113276800 HGVS Name: NC_000002.12:g.181457493C>A

Context nucleotide sequence:
GGCCCGAACGCTCCGCCCGCGGTGGG [C>A] CGACTTCCCCTCCTCTTCCCTCTCTCCT (Strand: +)

Also known as:

Comments: rs113276800-A showed a positive association with overt ischemic stroke in pediatric patients with sickle cell anemia of sub-Saharan African ancestry in Portugal.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Stroke [HP:0001297] [OMIM:601367]

Location

Chromosome: 2
Locus: NG_050623.1
Locus Location: 5602
Size: 1 bp
Located at: ITGA4
Specific Location: 5'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: sub-Saharan African
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Silva M, Vargas S, Coelho A, Ferreira E, Mendonça J, Vieira L, Maia R, Dias A, Ferreira T, Morais A, Soares IM, Lavinha J, Silva R, Kjöllerström P, Faustino P, Biomarkers and genetic modulators of cerebral vasculopathy in sub-Saharan ancestry children with sickle cell anemia., Blood Cells Mol Dis, 83(0), 102436, 2020
Created on 2022-03-24 11:41:13, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.