IthaID: 39


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CAP +33 (C>G) HGVS Name: HBB:c.-18C>G
Hb Name: N/A Protein Info: β nt 33 C>G

Context nucleotide sequence:
CTTCTGACACAACTGTGTTCACTAG [C/G] AACCTCAAACAGACACCATGGTGCA (Strand: -)

Also known as:

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β++ (silent)
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70577
Size: 1 bp
Located at: β
Specific Location: 5'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: 5'UTR (Transcription)
Ethnic Origin: Greek Cypriot
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

Frequencies

Publications / Origin

  1. Ho PJ, Rochette J, Fisher CA, Wonke B, Jarvis MK, Yardumian A, Thein SL, Moderate reduction of beta-globin gene transcript by a novel mutation in the 5' untranslated region: a study of its interaction with other genotypes in two families., Blood, 87(3), 1170-8, 1996
Created on 2010-06-16 16:13:14, Last reviewed on 2014-04-08 12:02:49 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.