IthaID: 3898

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs1409419	HGVS Name:	NC_000001.11:g.100717840T>C

Context nucleotide sequence:
AAGTAGAAAATATAGGCATATTAA [T>C] CAGTAAATGCAGAATGATAAATGCT (Strand: +)

Also known as:

Comments: 2KB Upstream Variant - T allele showed a positive association with overt ischemic stroke and high time averaged mean velocity (TAMMV) values obtained during transcranial Doppler (TCD) screening in pediatric patients with sickle cell anemia of sub-Saharan African ancestry in Portugal.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	Stroke [HP:0001297] [OMIM:601367]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	1
Locus:	NG_023034.2
Locus Location:	3100
Size:	1 bp
Located at:	VCAM1
Specific Location:	N/A

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	sub-Saharan African
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Publications / Origin

Silva M, Vargas S, Coelho A, Ferreira E, Mendonça J, Vieira L, Maia R, Dias A, Ferreira T, Morais A, Soares IM, Lavinha J, Silva R, Kjöllerström P, Faustino P, Biomarkers and genetic modulators of cerebral vasculopathy in sub-Saharan ancestry children with sickle cell anemia., Blood Cells Mol Dis, 83(0), 102436, 2020

Created on 2022-03-23 18:03:29, Last reviewed on 2022-03-24 11:46:16 (Show full history)

A/A	Date	Curator(s)	Comments
1	2022-03-23 18:03:29	The IthaGenes Curation Team	Created
2	2022-03-24 11:45:33	The IthaGenes Curation Team	Reviewed. Ethnic origin.
3	2022-03-24 11:46:16	The IthaGenes Curation Team	Reviewed. Ethnic origin.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.