IthaID: 3896

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 132 (AAA>AA-) HGVS Name: HBB:c.399del
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CACCAGTGCAGGCTGCCTATCAGAA [A/-] GTGGTGGCTGGTGTGGCTAATGCCC (Strand: -)

Comments: Found as a de novo mutation causing dominant phenotype β-thalassaemia major, in a 3-year-old male presented with severe anaemia. The frameshift mutation delayed the termination of translation, resulting in an elongated β-globin variant, with an additional 10 amino acids.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71973
Size: 1 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Zhou X, Chen T, Zhang Q, Qi M, Zhang L, Du J, Chi H, Shen B, Xu X, Lu Y, De novo HBB frameshift mutation in a patient with dominant β-thalassemia major., Int J Lab Hematol, 44(1), e21-e25, 2022
Created on 2022-03-01 23:25:56, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.