IthaID: 3895


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2073617 HGVS Name: NC_000008.11:g.118952044G>A

Context nucleotide sequence:
GGGGGGTGTGCAGAAAGCTCCAGG [G>A] TTAACGCTTTCAGGGCTGGGGCGG (Strand: +)

Also known as:

Comments: Reported in pediatric beta-thalassemia patients with a higher incidence in those with low spine bone mineral density.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Reduced bone mineral density [HP:0004349]

Location

Chromosome: 8
Locus: NG_012202.1
Locus Location: 5101
Size: 1 bp
Located at: OPG
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Egyptian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Youssry I, Saad N, Madboly M, Samy RM, Hamed ST, Tawfik H, Elbatrawy SR, Kaddah N, Abd Elaziz D, Bone health in pediatric transfusion-dependent beta-thalassemia: Circulating osteoprotegerin and RANKL system., Pediatr Blood Cancer, 69(1), e29377, 2022
Created on 2022-02-28 12:29:19, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.