
IthaID: 3893
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs9533156 | HGVS Name: | NC_000013.11:g.42573535T>C |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CACGCCCCTTTACCCTTTTCTCTGCAC [T>C] GTTTTCATCTTTATAAAGTCAGAGTT (Strand: +)
Comments: Associated with an increased risk of low bone mass density in pediatric beta-thalassemia patients.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Reduced bone mineral density [HP:0004349] |
Location
Chromosome: | 13 |
---|---|
Locus: | NG_008990.1 |
Locus Location: | 15800 |
Size: | 1 bp |
Located at: | RANKL |
Specific Location: | Intron |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Egyptian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Youssry I, Saad N, Madboly M, Samy RM, Hamed ST, Tawfik H, Elbatrawy SR, Kaddah N, Abd Elaziz D, Bone health in pediatric transfusion-dependent beta-thalassemia: Circulating osteoprotegerin and RANKL system., Pediatr Blood Cancer, 69(1), e29377, 2022
Created on 2022-02-28 12:06:41,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.