IthaID: 3885
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 17 (-C) | HGVS Name: | HBA2:c.54delC |
| Hb Name: | N/A | Protein Info: | α2 17(A15) Val>Val |
Context nucleotide sequence:
CGTCAAGGCCGCCTGGGGTAAGGT [C/-] GGCGCGCACGCTGGCGAGTATGGT (Strand: +)
Also known as: Hb Kunming
Comments: Found in a 26-year-old female presented with slight α-thalassemia phenotypes with hypochromic and microcytic erythrocytes. According to mutalyzer software, the nucleotide frameshift would result in a shortened α-globin chain with a total of 48 amino acids.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α⁺ |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 33829 |
| Size: | 1 bp |
| Located at: | α2 |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Chinese |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Zhang J, Xie M, Peng Z, Zhou X, Zhao T, Jin C, Yan Y, Zeng X, Li D, Zhang Y, Su J, Feng N, He J, Yao X, Lv T, Zhu B, Five novel globin gene mutations identified in five Chinese families by next-generation sequencing., Mol Genet Genomic Med, 9(12), e1835, 2021
Created on 2022-01-04 19:05:36,
Last reviewed on 2022-07-12 11:08:32 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.