IthaID: 3881


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs3759071 HGVS Name: NC_000011.10:g.5270302G>A | NC_000011.10:g.5270302G>T

Context nucleotide sequence:
TAGGAAAAAAAGTTTCAGCCAAAGC [G>A,T] CATTTAACATTTGCCTTAAAGGTGGT (Strand: +)

Also known as:

Comments: 2KB Upstream Variant - The G allele associated with >30% HbF levels in Kuwaiti patients with sickle cell disease.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: N/A
Size: 1 bp
Located at: ε
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Kuwaiti
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Akbulut-Jeradi N, Fernandez MJ, Al Khaldi R, Sukumaran J, Adekile A, Unique Polymorphisms at , and Loci Associated with HbF in Kuwaiti Patients with Sickle Cell Disease., J Pers Med, 11(6), , 2021
Created on 2021-12-27 09:14:50, Last reviewed on 2021-12-27 09:20:40 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.