IthaID: 3877


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: IVS I-114 G>T HGVS Name: HBA2:c.96-4G>T
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CCCCACCCCTCACTCTGCTTCTCCCC [G/T] CAGGATGTTCCTGTCCTTCCCCACCA (Strand: +)

Also known as:

Comments: Found in a 26-year-old Chinese female presented with normal hematological indices (Hb 11.9 g/dL, MCV 80.0 fL, MCH 25.0 pg, MCHC 31.2 g/L). Hb analysis shown normal levels of Hb 97.8% and HbA2 2.2%.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:N/A
Associated Phenotypes: N/A

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 33984
Size: 1 bp
Located at: α2
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Splice junction (mRNA Processing)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Li, Youqiong2021-11-09First report.
Created on 2021-12-15 13:35:46, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.