IthaID: 3873


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs886037865 HGVS Name: NC_000002.12:g.60546213C>A

Context nucleotide sequence:
GGAAGTTCATCTGGCACTGCCCA [C>A] AGGTGAGGAGGTCATGATCCCCTTC (Strand: +)

Protein sequence:
MSRRKQGKPQHLSKREFSPEPLEAILTDDEPDHGPLGAPEGDHDLLTFGQCQMNFPLGDILIFIEHKRKQCNGSLCLEKAVDKPPSPSPIEMKKASNPVEVGIQVTPEDDDCLSTSSRGICPKQEHIADKLLHWRGLSSPRSAHGALIPTPGMSAEYAPQGICKDEPSSYTCTTCKQPFTSAWFLLQHAQNTHGLRIYLESEHGSPLTPRVGIPSGLGAECPSQPPLHGIHIADNNPFNLLRIPGSVSREASGLAEGRFPPTPPLFSPPPRHHLDPHRIERLGAEEMALATHHPSAFDRVLRLNPMAMEPPAMDFSRRLRELAGNTSSPPLSPGRPSPMQRLLQPFQPGSKPPFLATPPLPPLQSAPPPSQPPVKSKSCEFCGKTFKFQSNLVVHRRSHTGEKPYKCNLCDHACTQASKLKRHMKTHMHKSSPMTVKSDDGLSTASSPEPGTSDLVGSASSALKSVVAKFKSENDPNLIPENGDEEEEEDDEEEEEEEEEEEEELTESERVDYGFGLSLEAARHHENSSRGAVVGVGDESRALPDVMQGMVLSSMQHFSEAFHQVLGEKHKRGHLAEAEGHRDTCDEDSVAGESDRIDDGTVNGRGCSPGESASGGLSKKLLLGSPSSLSPFSKRIKLEKEFDLPPAAMPNTENVYSQWLAGYAASRQLKDPFLSFGDSRQSPFASSSEHSSENGSLRFSTPPGELDGGISGRSGTGSGGSTPHISGPGPGRPSSKEGRRSDTCEYCGKVFKNCSNLTVHRRSHTGERPYKCELCNYACAQSSKLTRHMKTHGQVGKDVYKCEICKMPFSVYSTLEKHMKKWHSDRVLNNDIKTE

Also known as:

Comments: Reported in individuals with neurodevelopmental disorder with persistence of fetal haemoglobin. Functional work using cord blood CD34+ HSPCs showed that this missense variant destabilizes the XL protein isoform via the ZnF0 N-terminal C2HC zinc finger of the BCL11A, and promotes proteasomal degradation of BCL11A.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 2
Locus: NG_011968.1
Locus Location: 12286
Size: 1 bp
Located at: BCL11A
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Shen Y, Li R, Teichert K, Montbleau KE, Verboon JM, Voit RA, Sankaran VG, Pathogenic BCL11A variants provide insights into the mechanisms of human fetal hemoglobin silencing., PLoS Genet, 17(10), e1009835, 2021
Created on 2021-11-02 13:42:20, Last reviewed on 2021-11-02 13:43:26 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.