IthaID: 3854
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 66/67 (-AAAG) | HGVS Name: | HBB:c.199_202delAAAG |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CCCTAAGGTGAAGGCTCATGGCAAG [AAAG/-] TGCTCGGTGCCTTTAGTGATGGCCT (Strand: -)
Also known as:
Comments: Found in a 5-year-old male in compound heterozygosity with the IVS I-5 (G>C) [IthaID:107]. The patient presented with a prolonged blood transfusion history from the age of 8 months old. The frameshift mutation predicted to produce a truncated β-globin chain that shown absence affinity for heme molecules, using bioinformatics tools
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β0 |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70923 |
Size: | 4 bp |
Located at: | β |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Deletion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Indian |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
- Chauhan W, Afzal M, Zaka-Ur-Rab Z, Noorani MS, A Novel Frameshift Mutation, Deletion of HBB:c.199_202delAAAG [Codon 66/67 (-AAAG)] in β-Thalassemia Major Patients from the Western Region of Uttar Pradesh, India., Appl Clin Genet, 14(0), 77-85, 2021
Created on 2021-09-23 08:58:55,
Last reviewed on 2021-09-23 10:19:17 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2021-09-23 08:58:55 | The IthaGenes Curation Team | Created |
2 | 2021-09-23 08:59:50 | The IthaGenes Curation Team | Reviewed. Reference added. |
3 | 2021-09-23 10:14:33 | The IthaGenes Curation Team | Reviewed. Reference added. |
4 | 2021-09-23 10:19:17 | The IthaGenes Curation Team | Reviewed. Reference added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-03-28 09:17:36