IthaID: 3854

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	N/A
Common Name:	CD 66/67 (-AAAG)	HGVS Name:	HBB:c.199_202delAAAG
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
CCCTAAGGTGAAGGCTCATGGCAAG [AAAG/-] TGCTCGGTGCCTTTAGTGATGGCCT (Strand: -)

Also known as:

Comments: Found in a 5-year-old male in compound heterozygosity with the IVS I-5 (G>C) [IthaID:107]. The patient presented with a prolonged blood transfusion history from the age of 8 months old. The frameshift mutation predicted to produce a truncated β-globin chain that shown absence affinity for heme molecules, using bioinformatics tools

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	β-thalassaemia
Allele Phenotype:	β0
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	70923
Size:	4 bp
Located at:	β
Specific Location:	Exon 2

Other details

Type of Mutation:	Point-Mutation(Deletion)
Effect on Gene/Protein Function:	Frameshift (Translation)
Ethnic Origin:	Indian
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Publications / Origin

Chauhan W, Afzal M, Zaka-Ur-Rab Z, Noorani MS, A Novel Frameshift Mutation, Deletion of HBB:c.199_202delAAAG [Codon 66/67 (-AAAG)] in β-Thalassemia Major Patients from the Western Region of Uttar Pradesh, India., Appl Clin Genet, 14(0), 77-85, 2021

Created on 2021-09-23 08:58:55, Last reviewed on 2021-09-23 10:19:17 (Show full history)

A/A	Date	Curator(s)	Comments
1	2021-09-23 08:58:55	The IthaGenes Curation Team	Created
2	2021-09-23 08:59:50	The IthaGenes Curation Team	Reviewed. Reference added.
3	2021-09-23 10:14:33	The IthaGenes Curation Team	Reviewed. Reference added.
4	2021-09-23 10:19:17	The IthaGenes Curation Team	Reviewed. Reference added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.