
IthaID: 3850
Names and Sequences
Functionality: | Neutral polymorphism | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | CD 3 CTG>TTG [Leu>Leu] | HGVS Name: | HBB:c.10C>T |
Context nucleotide sequence:
ACCTCAAACAGACACCATGGTGCAT [C/T] TGACTCCTGAGGAGAAGTCTGCCGT (Strand: -)
Also known as:
Comments: Found in a newborn associated with Hb Constant Spring [IthaID: 418], presented with Hb 13.5 g/dL, RBC 4.09×10^12/L, MCV 106.4 fL and MCH 33 pg. Capillary electrophoresis shown the presence of Hb Bart’s 1.3% and HbA 24.7%, HbF 73.5%, HbA2 0.3% and Hb CS 0.2%.
External Links
Phenotype
Allele Phenotype: | Neutral |
---|---|
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70604 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Chinese |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Microattributions
A/A | Contributor(s) | Date | Comments |
---|---|---|---|
1 | Li, Youqiong | 2021-09-14 | First report. |
Created on 2021-09-17 12:09:44,
Last reviewed on 2021-09-17 13:07:09 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2021-09-17 12:09:44 | The IthaGenes Curation Team | Created |
2 | 2021-09-17 13:07:09 | The IthaGenes Curation Team | Reviewed. Link added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2022-08-11 13:37:51