IthaID: 3838

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs638135 HGVS Name: NC_000011.10:g.86474646A>G

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TGCATATCAGGTTGGCATGAGGCCAC [A>G] GGTGTCCTCCATGAAGGTTTTTTGATT (Strand: +)

Comments: Associated with disease severity in Thai individuals with β0-thalassaemia/HbE (p = 1.1E-3, Bonf. P = 8.3E-1, FDR 0.01).

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Severity [HP:0012824]

Location

Chromosome: 11
Locus: NM_006680.3
Locus Location: N/A
Size: 1 bp
Located at: ME3
Specific Location: Intron 7

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Thai
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Sherva R, Sripichai O, Abel K, Ma Q, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Svasti S, Fucharoen S, Braun A, Farrer LA, Genetic modifiers of Hb E/beta0 thalassemia identified by a two-stage genome-wide association study., BMC Med. Genet. , 11(0), 51, 2010
Created on 2021-07-19 18:04:41, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.