IthaID: 3836


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs545537 HGVS Name: NC_000006.12:g.117323878C>T

Context nucleotide sequence:
GGATCTTCTGCAAAAGAGGCCCTA [C>T] TCATTCCAAACCAGCCTGTCTGCTT (Strand: +)

Also known as:

Comments: Associated with disease severity in Thai individuals with HbE/β0-thalassemia (p = 8.4E-4, Bonf. P = 6.3E-1, FDR = 0.01).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Severity [HP:0012824]

Location

Chromosome: 6
Locus: NG_033929.1
Locus Location: 106978
Size: 1 bp
Located at: ROS1
Specific Location: Intron 35

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Thai
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Sherva R, Sripichai O, Abel K, Ma Q, Whitacre J, Angkachatchai V, Makarasara W, Winichagoon P, Svasti S, Fucharoen S, Braun A, Farrer LA, Genetic modifiers of Hb E/beta0 thalassemia identified by a two-stage genome-wide association study., BMC Med. Genet. , 11(0), 51, 2010
Created on 2021-07-19 16:23:50, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.