IthaID: 38

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CAP +22 (G>A) HGVS Name: HBB:c.-29G>A
Hb Name: N/A Protein Info: β nt 22 G>A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GCTTACATTTGCTTCTGACACAACT [A/G] TGTTCACTAGCAACCTCAAACAGAC (Strand: -)

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β++
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70566
Size: 1 bp
Located at: β
Specific Location: 5'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: 5'UTR (Transcription)
Ethnic Origin: Mediterranean, Bulgarian,Turkish
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Oner R, Agarwal S, Dimovski AJ, Efremov GD, Petkov GH, Altay C, Gurgey A, Huisman TH, The G----A mutation at position +22 3' to the Cap site of the beta-globin gene as a possible cause for a beta-thalassemia., Hemoglobin, 15(1), 67-76, 1991
  2. Cai SP, Eng B, Francombe WH, Olivieri NF, Kendall AG, Waye JS, Chui DH, Two novel beta-thalassemia mutations in the 5' and 3' noncoding regions of the beta-globin gene., Blood, 79(5), 1342-6, 1992
  3. Akar E, Ozdemir S, Hakki Timur I, Akar N, First observation of homozygous hemoglobin hamadan (B 56 (D7) GLY-ARG) and beta thalassemia (-29 G>A)- hemoglobin Hamadan combination in a Turkish family., American journal of hematology, 74(4), 280-2, 2003
Created on 2010-06-16 16:13:14, Last reviewed on 2023-04-25 15:15:49 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.