IthaID: 3796
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | IVS II-716 (+T) | HGVS Name: | HBB:c.316-135dupT |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
ATGTAACTGATGTAAGAGGTT [-/T] CATATTGCTAATAGCAGCTACA (Strand: -)
Also known as:
Comments: Found in a 6-month-old Croatian girl in compound heterozygosity with the IVS I-2 (T>C) [IthaID:105] presented with β-thalassemia minor.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71755 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Croatian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Vucak J, Turudic D, Milosevic D, Bilic M, Salek Z, Rincic M, Bilic E, Genotype-phenotype Correlation of β-Thalassemia in Croatian Patients: A Specific HBB Gene Mutations., J Pediatr Hematol Oncol, 40(2), e77-e82, 2018
Created on 2021-06-14 10:58:04,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.