IthaID: 3793


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 7 (-GAG) [-Glu] HGVS Name: HBB:c.22_24delGAG
Hb Name: Hb Xinyi Protein Info: N/A

Context nucleotide sequence:
CATGGTGCATCTGACTCCTGAG [GAG/-] AAGTCTGCCGTTACTGCCCTGT (Strand: -)

Also known as:

Comments: Found in a 6-month-old male in compound heterozygosity with Hb Dahua [IthaID: 3747] and Hb Q-Thailand [IthaID: 607] with no clinical presentation. He presented with Hb 11.9 g/dL, RBC 4.74×10^12/L, MCV 80.0 fL, and MCH 25.0 pg. Capillary electrophoresis shown HbA 65.9 %, Hb Xinyi 7.6 %, Hb F+Hb Q-Thailand 22.2 %, HbA2 1.3 %, Hb Q-Thailand-HbA2 1.1% and Hb Xinyi-Q-Thailand 1.9%.

External Links

No available links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70616
Size: 3 bp
Located at: β
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/AContributor(s)DateComments
1Li, Youqiong2021-06-03First report.
Created on 2021-06-07 10:40:39, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.