
IthaID: 3783
Names and Sequences
Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
---|---|---|---|
Common Name: | IVS II-64 A>G | HGVS Name: | HBA2:c.300+64A>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ATGGCGCCTTCCTCTCAGGGCAG [A/G] GGATCACGCGGGTTGCGGGAGGT (Strand: +)
Comments: Variation is reported in ClinVar as Conflicting interpretations of pathogenicity Likely benign(1);Uncertain significance(1) with an 1-star review status (criteria provided, conflicting interpretations).
Phenotype
Allele Phenotype: | Neutral |
---|---|
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 34256 |
Size: | 1 bp |
Located at: | α2 |
Specific Location: | Intron 2 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | N/A |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Created on 2021-04-05 12:57:29,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.