IthaID: 3782
Names and Sequences
Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
---|---|---|---|
Common Name: | IVS I-41 G>T | HGVS Name: | NM_000558.5(HBA1):c.95+41G>T |
Context nucleotide sequence:
CTCCGACCCGGGCTCCTCGCCC [G/T] CCCGGACCCACAGGCCACCCTC (Strand: +)
Also known as:
Comments: Variation is reported in ClinVar as Likely benign with a 2-star review status (multiple submitters, no conflict).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
Allele Phenotype: | Neutral |
---|---|
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 37715 |
Size: | 1 bp |
Located at: | α1 |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | N/A |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Publications / Origin
To the best of our knowledge, this is unpublished data. Please use with caution!
Created on 2021-04-05 12:52:37,
Last reviewed on 2024-04-12 12:35:12 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2021-04-05 12:52:37 | The IthaGenes Curation Team | Created |
2 | 2024-04-12 12:35:12 | The IthaGenes Curation Team | Reviewed. HGVS name, Chromosome and Locus location corrected. Link added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07