IthaID: 3768
Names and Sequences
| Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | IVS I-39 C>T | HGVS Name: | HBA1:c.95+39C>T |
Context nucleotide sequence:
TCCCCTGCTCCGACCCGGGCTCCTCGC [C/T] CGCCCGGACCCACAGGCCACCCTCAAC (Strand: +)
Also known as:
Comments: Variation is reported in ClinVar as Benign with a 2-star review status (multiple submitters, no conflict).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Allele Phenotype: | Neutral |
|---|---|
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 37713 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Black Cuban |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Scheps KG, De Paula SM, Bitsman AR, Freigeiro DH, Basack FN, Pennesi SP, Varela V, Coinheritance of a novel mutation on the HBA1 gene: c.187delG (p.W62fsX66) [codon 62 (-G) (α1)] with the α212 patchwork allele and Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T]., Hemoglobin, 37(5), 492-500, 2013
Created on 2021-04-02 13:51:24,
Last reviewed on 2021-04-03 10:37:39 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.