IthaID: 3764

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	N/A
Common Name:	-4 G>C	HGVS Name:	HBA1:c.-41C>G
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
GCATAAACCCTGGCGCGCTCGCGGGC [C/G] GGCACTCTTCTGGTCCCCACAGACTCA (Strand: +)

Also known as:

Comments: The substitution reported in a 17-year old male with Hb 14.4 g/dL, MCV 77.2 fL, MCH 24.2 pg, RBC 5.96 10^12/L and RDW 13.2 % with normal HbA2 value. GAP-PCR showed presence of two abnormal bands around 3.7 gene deletion. Molecular analysis showed the substitution C>G at both HbA1 and HbA2 regions.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	α-thalassaemia
Allele Phenotype:	N/A
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	16
Locus:	NG_000006.1
Locus Location:	37539
Size:	1 bp
Located at:	α1
Specific Location:	Promoter

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	Promoter (Transcription)
Ethnic Origin:	Malay, Indian
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Microattributions

A/A	Contributor(s)	Date	Comments
1	Mohd Yasin, Norafiza	2020-11-24	First report.

Created on 2021-04-01 00:14:14, Last reviewed on 2021-12-17 10:05:33 (Show full history)

A/A	Date	Curator(s)	Comments
1	2021-04-01 00:14:14	The IthaGenes Curation Team	Created
2	2021-04-01 00:15:30	The IthaGenes Curation Team	Reviewed. Common name added.
3	2021-12-17 10:05:00	The IthaGenes Curation Team	Reviewed. HGVS name and location corrected.
4	2021-12-17 10:05:33	The IthaGenes Curation Team	Reviewed. Link corrected.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.