IthaID: 375


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 51-55 (-13 bp deletion) HGVS Name: HBA1:c.155_167delGCTCTGCCCAGGT
Hb Name: N/A Protein Info: α1 51 - 55 (-GCTCTGCCCAGGT); modified C-terminal sequence: (51)Val-Arg-Ala-Thr-Ala-Arg-Arg-Trp-Pro-Thr- (61)Arg-COOH

Context nucleotide sequence:
TTCCCGCACTTCGACCTGAGCCACG [-/GCTCTGCCCAGGT] TAAGGGCCACGGCAAGAAGGTGGCC (Strand: +)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37851
Size: 13 bp
Located at: α1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Spanish
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Ayala S, Colomer D, Aymerich M, Abella E, Vives Corrons JL, First description of a frameshift mutation in the alpha1-globin gene associated with alpha-thalassaemia., British journal of haematology, 98(1), 47-50, 1997
Created on 2010-06-16 16:13:15, Last reviewed on 2014-04-08 17:32:24 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.