
IthaID: 3745
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | IVS I-1 G>A | HGVS Name: | HBA2:c.95+1G>A |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GAGTATGGTGCGGAGGCCCTGGAGAG [G/A] TGAGGCTCCCTCCCCTGCTCCGACCCG (Strand: +)
Comments: Found in patients with microcytosis and hypochromia. In the presence of the G>A mutation, a cryptic splice site 49 bp upstream of the exon1/intron 1 boundary is activated and a premature stop codon is introduced between codons 48 and 49 in exon 2. As this premature stop codon is located 152 nts upstream of the last exon-exon junction, the mature mRNA may be degraded by the nonsense mediated decay mechanism or further processed to produce a truncated nonfunctional protein.
External Links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia |
Allele Phenotype: | α⁺ |
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 33871 |
Size: | 1 bp |
Located at: | α2 |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | Cryptic splice site (mRNA Processing), Frameshift (Translation) |
Ethnic Origin: | Canadian, Italian |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Waye JS, Eng B, Dutly F, Frischknecht H, alpha-Thalassemia caused by two novel splice mutations of the alpha2-globin gene: IVS-I-1 (G>A and G>T)., Hemoglobin, 33(6), 519-22, 2009
- Qadah T, Finlayson J, Ghassemifar R, In vitro characterization of the α-thalassemia point mutation HBA2:c.95+1G>A [IVS-I-1(G>A) (α2)]., Hemoglobin, 36(1), 38-46, 2012
Created on 2021-02-17 16:56:30,
Last reviewed on 2022-07-12 11:40:09 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.