IthaID: 3740
Names and Sequences
| Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | -5 C>T | HGVS Name: | HBA1:c.-42C>T |
Context nucleotide sequence:
AGCATAAACCCTGGCGCGCTCGCGGC [C/T] CGGCACTCTTCTGGTCCCCACAGACTC (Strand: +)
Also known as:
Comments: The -5 C>T found in one of the α3.7 hybrid gene of a homozygous patient of -α3.7 deletion presented with hypochromic microcytic anemia (MCV 64.6 fL, MCH 20.9 pg), low HbA2 1.3% and a normal ferritin value.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype: | Neutral |
|---|---|
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 37538 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Omani |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Hassan SM, Harteveld CL, Bakker E, Giordano PC, Molecular spectrum of α-globin gene defects in the Omani population., Hemoglobin, 38(6), 422-6, 2014
Created on 2021-02-12 15:40:09,
Last reviewed on 2021-02-24 19:47:06 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.